EST details — SGN-E109327

Search information 
Request: 109327Match: SGN-E109327
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3256Clone name: cLEC-20-A12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173504 is on microarray TOM1: SGN-S1-1-3.1.18.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3256 [cLEC-20-A12] Trace: SGN-T27598 EST: SGN-E205816 Direction: 5' Facility: TIGR
Clone: SGN-C173504 [TUS-16-E22] Trace: SGN-T196726 EST: SGN-E395400 Direction: 3' Facility: INRA
Clone: SGN-C173504 [TUS-16-E22] Trace: SGN-T196727 EST: SGN-E395401 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E109327Length: 604 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E109327 [] (called/trimmed by facility)
AGAGTTTCCTCACTAAGGGACAATTACAAGCTGCCCTAATTTTTATCACCGGAAAATTGCAACTTGTCGTCGGAAAACTCGACTAGATTCCGGCC
AAAACTCCGTCCTATGGCAATCGCCGACCACCACAAGTCACATAACTCAGACGGAAAGCTCTGGAAGCTTTGTCCTCTATGGCAATCAGGAACTA
CGTCTTCTTCTTCGTCGTCTACACAAAATCTTCACTCTCAGAATCACAGTCACCAAAACGGCGTCGGATCTAACAGCTCTCGTGCTTCTACGTCT
GTTAGCTCCGTTGCTAGATCACTGCTTCCGGCTAGACGTAGGCTTCGGCTCGATCCAGCTAACAGTCTCTACTTCCCTTATGAACCGGGAAAGCA
GGTGAAGAGTGCTGTAAAGATTAAGAACACTAGCAAATCTTATGTTGCATTTAAGTTTCAAACGACTGCACCAAAGAGCTGCTACATGCGACCTC
CCGGAGGCATTCTCGAACCCGGTGAAAGTGTTATTGCCACTGTCTTCAAGTTTGTGGAGCACCCTGAGAACAACGAAAAGCCTGTGGACCAAAAG
AGCAAAGTTAAGTTCAAGATCATAAGCTTGAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T27598 [Download] [View] Facility Assigned ID: TCACZ06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence