EST details — SGN-E111016

Search information 
Request: 111016Match: SGN-E111016
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77839Clone name: cLES-3-H12
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77839 [cLES-3-H12] Trace: SGN-T97588 EST: SGN-E284567 Direction: 5' Facility: TIGR
Clone: SGN-C190176 [TUS-59-L14] Trace: SGN-T340660 EST: SGN-E539785 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C190176 [TUS-59-L14] Trace: SGN-T349152 EST: SGN-E548277 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E111016Length: 214 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E111016 [] (called/trimmed by facility)
GCAGCTTAAAATGCTTATTATCCTCTTTAAATTTCAATTTTTAAACCAAATTTAGTCCAACAGGGGGGCTTGTTTGAACTATTCCACTAACTCAT
CACAAATGGGAAGCTAGCAGATCACCCAAGAGTTGGGGTCCTTTTCCACACTGTAATAGGGCTGATAAGCAGGAACAGGGGTTGGGCACTGGGGA
TAAGGTGGTTGATTTTGATATTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T97588 [Download] [View] Facility Assigned ID: TPSAL42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence