EST details — SGN-E114037

Search information 
Request: 114037Match: SGN-E114037
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C132558Clone name: cTOD-3-B6
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C132558 [cTOD-3-B6] Trace: SGN-T142138 EST: SGN-E329683 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E114037Length: 547 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E114037 [] (called/trimmed by facility)
GAAAGAACTAGATCACTCCAAGAGCCTTGACAAGGAAGAGGCTGTCATCATGCATAATATCGATGAGGATGAGATTTTTCCACCTGAAAAAAAAC
AGGAATAGTTTGTGCATTCGGAAAATAGAAGGCAATAAAAAGACTAAGACGCGCTTAATGAAGATGCGAAGCCTAGACTCTGCTGAGGAATCACC
AGTACATGGAAAATCTTTGTGTCTAGCAAGATCATTTAGTTCTCATTTTCTTATTAACATAGATGAGATGATGAGTGATGTTGGTAATGAAAAAG
GTGCACTTATAAGTAAGACTCCAAAAGGGAAAATGGGAATTTTCTCATTCGATCGATCCTCCATTTCCTCATCAGAAACATAAAATTAGCAGCCA
CAATTATGGCAGTGAACACATAGTTATATACTAGAAGCTAGGTTGCCTTTTTTATGTATGTGAATGTGATTTCTGAAAAAAGTCCCCTTGTTTGT
TGTTCAGAGAACAATATATTGAAATCGAAGGATCAGGAGGATGACGATTCATGCAGCTGGAATAGAATTCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T142138 [Download] [View] Facility Assigned ID: TFDAL03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence