EST details — SGN-E116659

Search information 
Request: 116659Match: SGN-E116659
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3982Clone name: cLEC-23-D11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173617 is on microarray TOM1: SGN-S1-1-2.2.18.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3982 [cLEC-23-D11] Trace: SGN-T28443 EST: SGN-E206484 Direction: 5' Facility: TIGR
Clone: SGN-C173617 [TUS-16-J15] Trace: SGN-T196701 EST: SGN-E395375 Direction: 5' Facility: INRA
Clone: SGN-C173617 [TUS-16-J15] Trace: SGN-T196805 EST: SGN-E395479 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E116659Length: 540 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E116659 [] (called/trimmed by facility)
CAGGGCATCCAGATTTCCTGAGAAGATCGGAGGAAATTTACCTGGGGTTCACTATATTCGGGATGTGGCAGATGCTGATTCATTAATATCCTCAC
TGGGGAAAGCAAAAAAACTTGTAGTTGTTGGTGGTGGTTATATAGGAATGGAAGTTGCTGCAGCTGCCGTAGCCTGGAAACTTGATACAACTATA
ATTTTTCCAGAAGAGCATCTCTTATCAAGACTGTTCACTCCTTCTCTTGCCCAAAAGTATGAACAACTCTACCAAGACAGTGGTGTCAAATTCGT
CAAGGGTGCTAAGATAAAACATCTAGAATCTGGTCCAGATAGCCGGGTAACTGCAGTTAAGCTTGAAGATGGATCAAGTATAGAGACAGACACGG
TTGTTATTGGTATTGGAGCAAAACCTGCCGTCAGTCCATTTGACATGGTTGGCTTAAACAACACTGTCGGTGGAATAGAGGTTGACGGACAGTTC
CGAACAAACATACCTGGAATCTTTGCCATTGGAGATGTTGCCGCATTTCCATTGAAGATATACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T28443 [Download] [View] Facility Assigned ID: TCADM18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence