EST details — SGN-C117171

Search information 
Request: 117171Match: SGN-C117171
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C117171Clone name: cTOA-5-G7
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOA-5-G7.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312321Length: 634 bp (954 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E312321 [] (trimmed) GGAGAGATCAGGAAGCAACAAATAAGGATGAAGGGTGGTACAGTTCAGATCAATTGGCACGACAGTAAGCCAGTTTTGTGCCTTGATTTTCACCA
CCTCACCGGCGTTATTGCTACTGGTGGCGCCGACTATGATATCAAGATGTGGGTGATTGATTCTGAAGAAAATGAAAAGAAAGCGCCTTCAGTTA
CATACCAGGCTAGCCTTTCTTACCATAGTGGTGCTGTGAATGCTCTTCGGTTCTCCCCTTCAGGAGAGCATTTGGCCTCTGGTGCCGATGGCGGC
GAGCTCATCATTTGGAAGCTACATTCTTCAGATGACAGCAAAACATGGAAAGTCCTAAAGACGTTATCATTTCACCGGAAGGATGTATTGGACTT
GCAGTGGTCTGCTGATGGTTCTTTTTTAATTTCTGGTTCTGTTGATAATTCATGCATCGTATGGGATGTCAACAAAGGTTCTGTTCATCAGATTT
TGGATGCTCATTTGCACTATGTGCAAGGTGTGGCATGGGATCCATTGTCCAAGTATACTGCCTCACTCAGTTCAGATAGATCTTGCCGGATTTAC
AGCAATAGACCATCTAAAACAAAAGGAGTTGAGAAGTTGAATTTTGTGTGTCAACATGTCATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312321] SGN-U573418 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T124613 [Download] [View] Facility Assigned ID: TFAAQ40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5