EST details — SGN-E120090

Search information 
Request: 120090Match: SGN-E120090
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C16435Clone name: cLED-16-I11
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16435 [cLED-16-I11] Trace: SGN-T52532 EST: SGN-E235959 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E120090Length: 331 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E120090 [] (called/trimmed by facility)
GCGAATTTCCGCTTCAGCAACCAACTTTTCTAATAAGTTTCGTGTGAAATTCGTGTTGCTTTAATTATTATGCATTTTATGTTTGAATTGTTGTA
GTTGGCAATTCATGTTTAATTTGTTTGTGTTTTTTTTTTTTTGAGAAAATATTGCATTGGGTTTCATTGGAAATTTGTGTTTTTTAAAAAGTAGT
GTGCATCTTATGTTTGGATTGTTGGTGTTGAGAATTCATTTTTAATTTGTTTTTTTTTTTGGGCAAATAATGAATTTAAAATTGTTGATTTTACT
CTTTAGTGGAAATGATTCATCACAATCTTTTAGTATTATTTGGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T52532 [Download] [View] Facility Assigned ID: TOVCI54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence