EST details — SGN-E120542

Search information 
Request: 120542Match: SGN-E120542
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C144200Clone name: cTOF-25-K24
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C144200 [cTOF-25-K24] Trace: SGN-T159289 EST: SGN-E347193 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E120542Length: 281 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E120542 [] (called/trimmed by facility)
CCTCAAAACCAGAGGACTAGTTCATCATTGAATAAAGAAGCATTACACTTGTCAAATTTATCGGAGTCCTCTAAACTGAAACTCCCTGATGCATC
ACTTCTATTAAATTCACCTACAATGCCAGGCCATCTTGGACTCAATACTGACCATTCTTCCCGAGTTGCAGCAGCCATGGCTGAAAATGCAACAA
GGAAGCGGGATATAAATGTATCAGCATCCACTTATCCACGCAGTAAGATTCCTAAAGGAACTTTGCCTAACATGAAGAATGTCCCTGAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T159289 [Download] [View] Facility Assigned ID: TOFDT72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence