EST details — SGN-E123132

Search information 
Request: 123132Match: SGN-E123132
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28930Clone name: cLEF-49-K17
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177069 is on microarray TOM1: SGN-S1-1-6.2.8.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28930 [cLEF-49-K17] Trace: SGN-T62514 EST: SGN-E249006 Direction: 5' Facility: TIGR
Clone: SGN-C177069 [TUS-25-J11] Trace: SGN-T181988 EST: SGN-E369035 Direction: 3' Facility: INRA
Clone: SGN-C177069 [TUS-25-J11] Trace: SGN-T181989 EST: SGN-E369036 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E123132Length: 507 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E123132 [] (called/trimmed by facility)
ACTAGCAAGAATAAAATAATAATTCAGACAGTCTATCAAACTAAACTATAAAAACTTTTCGATATGTAACATTATGACATGACATATTACAATAA
ATTTCTTACAATGGCTCTACCAACATCAGAAAGTTCATGAACATCTATATTTAATTTAGAAAGTGGTGAATATTTAATAGTTGTAGCTTTAAAAT
ATTCTTCACATTCTTGTGCATCACCAGAAGAACCAACCATTCCATCTTCTGCAAATTTTGGATCACCTTTTGTTAATGCTTCTATTGCTTCTGGC
ATACTTGCTGTTAAAATTACCTTATACGAAAAGGCACAATTCTTCAAAGGATCTTTCCAAGCTTGAGGAGGATTAGAATGCCTAAGTTTTGAAAT
AGTATTAGCAGCTTGATTAGCTTTAGATTTAATAGCATCAACCATAATTAATGCTAATGTTGTAATATCTCCTGCTTTTTCACTTCTTTTGTCTA
AAGACAAAGTTTTCACACACAAATTATAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T62514 [Download] [View] Facility Assigned ID: TMGHK69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence