EST details — SGN-E124056

Search information 
Request: 124056Match: SGN-E124056
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89031Clone name: cLEW-11-G24
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C89031 [cLEW-11-G24] Trace: SGN-T112931 EST: SGN-E300091 Direction: 5' Facility: TIGR
Clone: SGN-C191543 [TUS-63-E13] Trace: SGN-T343008 EST: SGN-E542133 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C191543 [TUS-63-E13] Trace: SGN-T349538 EST: SGN-E548663 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E124056Length: 536 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E124056 [] (called/trimmed by facility)
GCTCTTCCTCTTCAAATCTCAGCTACTCCTTTCTTTAAGTGCCTAACCTACATTCAAACCTCATATTTTCAACTACTACTACTATACTACAACAA
GAACAACTCCAATCTTTCTTTATTGTTAGTCTGCATCTGCTGACAGAATGAATAAACAAGAAATGCTCAAGTCTCAGACTTGTGTACTTAAAGTG
AACATACACTGTGATGGCTGTAAACAGAAGGTGAAAAAGAAATTGCAGAAGATTGAAGGTGTTTACACAGTGAAGATAGATTCAGACCAAAGCAA
AGTAACAGTGACAGGAAATGTTGATCCAGCAACGCTGATAAAGAAGCTAGTGAAATCAGGGAAACATGCAGAGCTATGGGGAGGAGGACAAAAGG
GAGGTTCTAATTTCAATATGATGAACAATCAGTTCATGAACATGCAAATGGACAACTTTAAAGGTGGAAAAGACAACAAATCTCAAAAGGGTGGT
GGTGGTGGTGGAAATAAGGAGCCGCCAAAGGGGAATGCGCAACAGTTTCTTCAGATGATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T112931 [Download] [View] Facility Assigned ID: TRDBP48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence