EST details — SGN-E12408

Search information 
Request: 12408Match: SGN-E12408
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24169Clone name: cLED-7-G21
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175247 is on microarray TOM1: SGN-S1-1-4.2.13.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24169 [cLED-7-G21] Trace: SGN-T50315 EST: SGN-E231806 Direction: 5' Facility: TIGR
Clone: SGN-C175247 [TUS-20-N13] Trace: SGN-T1356 EST: SGN-E378672 Direction: 5' Facility: Giov. Lab
Clone: SGN-C175247 [TUS-20-N13] Trace: SGN-T190005 EST: SGN-E377506 Direction: 3' Facility: INRA
Clone: SGN-C175247 [TUS-20-N13] Trace: SGN-T190006 EST: SGN-E377507 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E12408Length: 614 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E12408 [] (called/trimmed by facility)
GCACCAGCTATACCACCCACCCATGCACCCACCCACCTATCTAAACCATATTTTTTCCCTTTAATCTAATGGAGCTTCTCTTAGTATTCTCCCAA
TGTCCACCATTCCCTCCGCCGCCTACGGCGGTCCACCACCACCTATAACCACCACCAATACGCTCATCGAGAGCCTCAACAAAATACGCCTCGGC
TACGCAATTGCAATTGCCCTTGCCTTCCTCTTCCTGCTATCAACTCTCATCCTTTCATCTTACCTATGCTGCCGCTCCGCTGCCTATCGCCGCCG
TCAAGCCCAATCCCAGTCTCGAAACCCCAAACACCGGAATTTACATTCCGAGTGTAATTTTCGTTGCTGAGGAAGACGAAAACGACGACGTTTCA
TCTCAGAACACTTTCGCGGGCCTCAATCAAGCAGTAATCAACTCTTACCCTAAATTAATTTACTCAAGCAGAAACGGAAATTGGGGAAACGGAAA
CGGAAGCAGAAACGACGTCGTGTGTGCGATTTGTTTGTGCGATTACAAGGAAGCGGAGATGTTACGGATGTTACCTGAGTGTAAGCATTATTTTC
ATGTGATGTGCGTAGATGCGTGGCTTGAAATGAATGCTTCATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T50315 [Download] [View] Facility Assigned ID: TOVAY47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence