EST details — SGN-E12417

Search information 
Request: 12417Match: SGN-E12417
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24208Clone name: cLED-7-I17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175268 is on microarray TOM1: SGN-S1-1-7.3.13.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24208 [cLED-7-I17] Trace: SGN-T50480 EST: SGN-E231971 Direction: 5' Facility: TIGR
Clone: SGN-C175268 [TUS-20-O10] Trace: SGN-T189872 EST: SGN-E377661 Direction: 3' Facility: INRA
Clone: SGN-C175268 [TUS-20-O10] Trace: SGN-T189873 EST: SGN-E377662 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E12417Length: 572 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E12417 [] (called/trimmed by facility)
GCACCAGGTTGCATCAAGTTCTTGGAAACAGTTGGTCTGCTATTGCAGCAAGATTACCCGGAAGAACAGATAACGAAATAAAAAACATTTGGCAT
ACTCGTCTGAAGAAAAAAAGGAATGAATCTCAACTTAAAGAAACCCAATCGGAGCCTGAAAATACTAATGTAGATGTACATTTGGAGGAGGCCAA
CAATTCTAATGATAAACATTCCGAAATATCGAATCTTAAAATAAACATCGAAATCCAACAACAACCAAGTCCATCATCGTCAGTATCATCATCAA
GTGAAGATTCATGTTCAAATACGACTGCAACGAGTTCAGAGTCGAGAAATCAAATAATGTCCGATAATTTGTTAGAAATTGATGACGATATTTGG
TCCGAGGTAGTATGGGCACAAGTCGATGACAATTATGTTGATTTGTCATTAATGGAGGATAATTACCACATTAATTCTAGCTCTGATGATAATTG
GTTTTGGGATGATCTTTTTACAAGATCTAATGAGTTGATGTTAGAATTGCCTGAATTATGAGCAACAAACAAAAAAAAGGAAAAAAATGTAGAGT
TC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T50480 [Download] [View] Facility Assigned ID: TOVAY57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence