EST details — SGN-E124962

Search information 
Request: 124962Match: SGN-E124962
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C135802Clone name: cTOE-15-C5
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C135802 [cTOE-15-C5] Trace: SGN-T150644 EST: SGN-E338381 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E124962Length: 532 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E124962 [] (called/trimmed by facility)
GCCGAAATGCAGACCCAACTGGAAGATTCTGCGAAACCCATTGTCGATCCTCATGATATCGACTCAAAATTGGTGCAGAAGCTTGCTAATGATGC
ACTTGTCTGGTGCTCTCTTCGTGGACTTCTTGTTGGTGACAGAAATTCGGAGAGGTCAGGAACTATTCCTGGTGTTGATATGGTTCATGCTCCAG
TTGCTCTCATACCAATGTCATTTCCTGAAAGTCATTGGAAGCAAGCTTGTGAAGTTGCTCCTATTTTCAATGAACTCGTGGATCGCGTGAGTCAG
GATGGAGAATTTCTGCAGCAATCACTGTCTAGGACGAGAAAAGCTGATCCTTTCACCTCCAGATTACTAGAAATCCACTCCAAGATGTTAGAAAT
CAACAAGCTAGAGGAAATACGCTTGGGGTTGCATCGCTCAGACTATATGCTGGATGAGCAAACGAAATTACTTTTGCAAATAGAGCTTAACACAA
TCTCATCATCATTTCCAGGGCTAAGTTGTCTGGTCAGCGAGCTTCACAGGAGCTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T150644 [Download] [View] Facility Assigned ID: TAICE15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence