Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E126818

Search information 
Request: 126818Match: SGN-E126818
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87278Clone name: cLET-45-N20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C87278 [cLET-45-N20] Trace: SGN-T111690 EST: SGN-E300518 Direction: 5' Facility: TIGR
Clone: SGN-C180047 [TUS-33-F13] Trace: SGN-T186810 EST: SGN-E374196 Direction: 3' Facility: INRA
Clone: SGN-C180047 [TUS-33-F13] Trace: SGN-T186811 EST: SGN-E374197 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E126818Length: 431 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E126818 [] (called/trimmed by facility)
CTGGAGGATTCTTTCAACGAGGCCTTTGTAATGGTGGATGACCAACGGGCCAGAAGAAGTGGGCTTGCACTGCTGAAGAAAATAGCAGACTTGCC
AAGGGGAATAGTAGATCTTTCAGTTTTACCGGGATTTTGAAGTATGTACCAGTGTCCGCTTAGTTTGTGCCATACTATCATCTGAGGCATCAAAG
AAGAACAGCTATTGCCCATAAGCGGAGGAGAAAACAGCTAACAGACTAATGTTTTTTCCGCGGAGGCAGCTGCAACCACAACAGAGCGAACTAGA
GGAGAAACTGTTACATAAATCTGGTAACGATGTCATAATTTTGACTGTTGTACAAGTATGTAACAAGTGAATGAATAATAAAATGAACTATCGCT
TGTATGTTCACATTGCCTGAGGAATATATATCATTGTGTTTTAAGTTCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T111690 [Download] [View] Facility Assigned ID: TMEGX82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence