EST details — SGN-E12771

Search information 
Request: 12771Match: SGN-E12771
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84684Clone name: cLET-29-O15
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184786 is on microarray TOM1: SGN-S1-1-1.3.14.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C84684 [cLET-29-O15] Trace: SGN-T109666 EST: SGN-E297251 Direction: 5' Facility: TIGR
Clone: SGN-C184786 [TUS-45-K24] Trace: SGN-T198632 EST: SGN-E397306 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E12771Length: 359 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E12771 [] (called/trimmed by facility)
GTTTCTTCAGCTGCTGTTGCCACCCGCGGCAATGGTGCACAAGCTAGCATGGTTGCACCCTTCACTGGACTCAAGTACACTGCTTCTTTCCCTGT
TTCAAGGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTCAGTTGCATGCAGGTGTGGCCACCAATTAACATGAATAAGT
ACGAGACTCTGTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGTACCTATTGAAAAATGGATGGGGTCCTTGCTTGGAA
TTCAAGACTGAGCACGGATTTGTGTACCGTGAGAACCATACGTCACCAGGATACTACTATGGCAGATACTGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T109666 [Download] [View] Facility Assigned ID: TMEEI92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence