EST details — SGN-E127820

Search information 
Request: 127820Match: SGN-E127820
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95045Clone name: cLEX-6-O17
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95045 [cLEX-6-O17] Trace: SGN-T116086 EST: SGN-E304068 Direction: 3' Facility: TIGR
Clone: SGN-C95045 [cLEX-6-O17] Trace: SGN-T116225 EST: SGN-E304207 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E127820Length: 556 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E127820 [] (called/trimmed by facility)
TTCAGCCTTTTCTTCATTTTCCATTTCTGCTATCTTTCTCTGCTCATATCCATTAAACTTTACTCCATTCATCATTTGTATTGTGATAAAGGTGG
AGGAAAGAACACACATAGAGAAAGATTTTGAGCAAATAAAAGAACAAGTTGAGGGAGTTGCTGAGAAGGGCGAATTGGGTTTGGAAGAATGAGTG
CTTCTAGGTTTATAAAGTGTGCTACCGTGGGCGATGGACCTGTGGGTAAAACTCGTCTTCTCATTTCGTATACCAGCAACACTTTTCCCACTGAT
TATGTCCCAACTGTATTTGACAATTGTAGTGCAAATGTGGCTGTCGATGGGAGCACTGTTAATCTGGGGCTCTGGGATACTGCACGTCATGAGGA
TTACAATAGATTAAGACCTTTGAGCTATCGTGGGGCTGATGTATCTATACTGGCATTTTCTCTCATTAGCAAGGCGAGCTATGAAAATGTCTCCA
AAACGTGGATTCCTGAATTGAGGCATTATGCTCCTGGAGTTCCAATTATTCTTGTTGGAACAAAGCTAGATCTCCGAGAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T116225 [Download] [View] Facility Assigned ID: TRXAU93THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence