EST details — SGN-E127913

Search information 
Request: 127913Match: SGN-E127913
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32287Clone name: cLEG-18-E1
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183056 is on microarray TOM1: SGN-S1-1-3.3.3.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32287 [cLEG-18-E1] Trace: SGN-T67268 EST: SGN-E250494 Direction: 5' Facility: TIGR
Clone: SGN-C183056 [TUS-41-C22] Trace: SGN-T196486 EST: SGN-E395160 Direction: 3' Facility: INRA
Clone: SGN-C183056 [TUS-41-C22] Trace: SGN-T196487 EST: SGN-E395161 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E127913Length: 687 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E127913 [] (called/trimmed by facility)
GTTTTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTGCCTTGTTATGGGTTGTTTCTCCTTGTGACGTCTCAAATGGGACAAGTTTCATGG
AATCAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCATAGGAATTTGGTGTCCAATGAGAGAATCAATAGAGGTGGTGGAAAGCAAACT
AATAATGGACGGAAATTTTCTGTACGGTCTGCTATTTTGGCTACTCCATCTGGAGAACGGACGATGACATCGGAACAGATGGTCTATGATGTGGT
TTTGAGGCAGGCAGCCTTGGTGAAGAGGCAACTGAGATCTACCAATGAGTTAGAAGTGAAGCCGGATATACCTATTCCGGGGAATTTGGGCTTGT
TGAGTGAAGCATATGATAGGTGTGGTGAAGTATGTGCAGAGTATGCAAAGACGTTTAACTTAGGAACTATGCTAATGACTCCCGAGAGAAGAAGG
GCTATCTGGGCAATATATGTATGGTGCAGAAGAACAGATGAACTTGTTGATGGCCCAAACGCATCATATATTACCCCGGCAGCCTTAGATAGGTG
GGAAAATAGGCTAGAAGATGTTTTCAATGGGCGGCCATTTGACATGCTCGATGGTGCTTTGTCCGATACAGTTTCTAACTTTCCAGTTGATATTC
AGCCATTCAGAGATATGATTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T67268 [Download] [View] Facility Assigned ID: TBFCQ25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence