EST details — SGN-E128307

Search information 
Request: 128307Match: SGN-E128307
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98265Clone name: cLEY-26-N4
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C98265 [cLEY-26-N4] Trace: SGN-T121478 EST: SGN-E309660 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E128307Length: 291 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E128307 [] (called/trimmed by facility)
TGATTTTCTCCATGCTATGTTTGGTCTTTCTTGTTGGCAAAAGCTAGATAGATATATTCTATTCTATACTAGCCAGCCTGCATACAAAGTCAGAA
CCATATGTTGAGTAGTAAAATTATGACGACTGTTGAACTTCGAGCATCTGATTTATCACATGTCTCCATTTTCTTGCTCAACTATTTGAAGAAAT
ATAGTTGATGTTGGTTAGTGGATTCGAAGTGATGAACTAACTATTTGCTTTGATCCATAATGTCTAAATTGCTGCTGCTGTGATATTTACATTTG
CAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T121478 [Download] [View] Facility Assigned ID: TRYDZ74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence