EST details — SGN-E128349

Search information 
Request: 128349Match: SGN-E128349
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98281Clone name: cLEY-26-P14
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C98281 [cLEY-26-P14] Trace: SGN-T121598 EST: SGN-E309780 Direction: 5' Facility: TIGR
Clone: SGN-C193285 [TUS-67-N3] Trace: SGN-T346004 EST: SGN-E545129 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C193285 [TUS-67-N3] Trace: SGN-T350031 EST: SGN-E549156 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E128349Length: 590 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E128349 [] (called/trimmed by facility)
CAAGAGTGGTCCTGTGCGTTTTCGATCAAGTGATGTGTTTACCTTGGATCTGAGTGAGGAAGAACCCTGCTGGAGATGTGTTACAGGAAGTGGAA
TGCCTGGTGCGGGAAATCCTGGAGGTCTTGCTCCTTCCCCAAGGCTTGATCATGTGGCATTAAGTCTCCCTGGTGGCAGAGTTCTGGTCTTTGGT
GGGTCCATTACTTCTGGTCTCCACTCAGGATCACAGCTCTACATTTTGGATCCAACTGAAGAGAAGCCAACATGGAGGATATTGAATGTGACTGG
TCGGGCTCCAAGTATTGCTTGGGGACATAATACATGTGTTGTTGGCGGAACTAGAGCAATAGTCATCGGAGGTCAAACTGGGGAAGACTGGATGC
TCGGTGAGTTGCATGAACTCTCTTTAGCAAGCTCTGTTGTTGTATGAATAAAAGAAAGGTAATAATCAAGAGAAGGTGTTGTACTGAAAATTTTG
CCTCAAGAATTAAGGAATTCCCGAGCAAACTATTGCAGTGCGGTTTTGGCATTGCACCAAATGCATAGTTGATTAGCTTGTTTATTCTTGTATGG
TCCTGTTGAGAACTTAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T121598 [Download] [View] Facility Assigned ID: TRYDZ91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence