SGN ID: SGN-C128267 | Clone name: cTOC-5-H4 |  | Order Clone |
|
Library Name: cTOC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E129737 | Length: 146 bp (called/trimmed by facility)
|
Status: Legacy Chimera not assessed | Direction: 5' |
>SGN-E129737 [] (called/trimmed by facility)
CGCCCATCATCTCTCTCTTTAAATATGGCTGAAAATAGTGGAAAAGCGATTGGAAGAAACTCAAGAACCTCCCGTGTTGCGCTTAATGAAAGAAT
TCTTTCCTCCATGTCACGAAAATCTATTGCTGCTCATCCATGGCATGACCT
[BLAST] [AA Translate]
SGN-ID: SGN-T136943 [Download] [View] |
Facility Assigned ID: TFCAT38THB
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation