EST details — SGN-E129737

Search information 
Request: 129737Match: SGN-E129737
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C128267Clone name: cTOC-5-H4
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C128267 [cTOC-5-H4] Trace: SGN-T136943 EST: SGN-E323794 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E129737Length: 146 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E129737 [] (called/trimmed by facility)
CGCCCATCATCTCTCTCTTTAAATATGGCTGAAAATAGTGGAAAAGCGATTGGAAGAAACTCAAGAACCTCCCGTGTTGCGCTTAATGAAAGAAT
TCTTTCCTCCATGTCACGAAAATCTATTGCTGCTCATCCATGGCATGACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T136943 [Download] [View] Facility Assigned ID: TFCAT38THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence