EST details — SGN-E131239

Search information 
Request: 131239Match: SGN-E131239
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28158Clone name: cLEF-46-L8
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176912 is on microarray TOM1: SGN-S1-1-3.3.8.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28158 [cLEF-46-L8] Trace: SGN-T61670 EST: SGN-E247259 Direction: 5' Facility: TIGR
Clone: SGN-C176912 [TUS-25-C22] Trace: SGN-T181809 EST: SGN-E369317 Direction: 3' Facility: INRA
Clone: SGN-C176912 [TUS-25-C22] Trace: SGN-T181810 EST: SGN-E369318 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E131239Length: 535 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E131239 [] (called/trimmed by facility)
CTGGGATCCCTAAATTTCTCCTCATTTTCTCTTTACCATTTCTCTATTCTCATTTTCATTCACCTTATTCCCTTTCCCCTCTTCTACAATTCTCT
CTGAACTTTCCCTTTCGTAGAATTAGGGTTAGGGTTTCACCAAGAGAACCAAAGAAAACACCATTGGCATGTCTCGATTTTCTTCTCTGCTGGGT
TTTCAAGCCATTCTGAAGAAACGACATTGAAAGGAATTGGAGAGGTTAAAAGAAACGGAAACAAGAAGCTCCAAGATACCACATTTAATCTCTTT
TTTTCTTTTTAAATTTTTTCTGGGATCAGGTCTTCTAAAGAAGATCTGAAAAGAGGAGGGTTATTGTTGGTTTTCTGAATAGCCGGGAAAAATGA
GTGCTTCAAGGTTTATCAAATGTGTTACCGTCGGCGATGGTGCCGTTGGAAAGACGTGTCTCTTGATTTCTTACACCAGCAATACCTTCCCCACG
GATTATGTGCCCACCGTGTTCGACAATTTCAGTGCAAATGTGGTCGTCAATGGGAGCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T61670 [Download] [View] Facility Assigned ID: TMGHB64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence