EST details — SGN-E132810

Search information 
Request: 132810Match: SGN-E132810
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32933Clone name: cLEG-24-J4
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32933 [cLEG-24-J4] Trace: SGN-T67708 EST: SGN-E253460 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E132810Length: 634 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E132810 [] (called/trimmed by facility)
TGCTGGTGGACCTGGTGGGGCTACATATTTCCATACATGTGATGGACCAAATGTGTTCAGATTCAATCCAAGAAATGCCAATGATATCTTTGCAG
AATTTTTTGGGTTTCAAACCCCGTTTGGCGGTGGTGGGATGGGAGGCGGCGGCGGTGGTGGGATGAGAGGTGCAAGGTTTTCTAGTTCAATGTTT
GGAGATGATATCTTCAGTTCATTTGGAGAAGGCAGACCAACCATACGGAAGGCGCCACCGATTGAACGAACAGTCCCTTGTAGTCTAGAAGAACT
TTATAGTGGGACAACCAAGAAGATGAAGATCTCTAGGGAGATTGCTGATGCAAGTGGGAAGACTTTACCAGTAGAAGAAATTCTGACCATTATAA
TCAAACCTGGCTGGAAGAAGGGAACGAAGATTACATTCACAGAGAAAGGAAATGAAGAGCCAAACGTTCTTCCTGCAGATCTCGTGTTCACAATT
GATCAGAAACCGCACAGTGTTTTCACAAGGGATGGGAATGACCTTGTAATCAATCAGAATATCTCACTTGTTGAAGCATTAACAGGTTACACAGC
CCATGTAACAACGCTTGATGGAAGAAAACTGACTATTCCTATCAACAAGGTAATACACCCAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T67708 [Download] [View] Facility Assigned ID: TBFDR50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence