EST details — SGN-E133054

Search information 
Request: 133054Match: SGN-E133054
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C92179Clone name: cLEX-10-F6
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C92179 [cLEX-10-F6] Trace: SGN-T116830 EST: SGN-E305056 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E133054Length: 498 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E133054 [] (called/trimmed by facility)
CCCATTAATTATGAGTGATTACAAAATCCCCAAAATTAATCTCACCAAATTAGACAAGCACTCAAATTCTTGGGTACCATTATGCAATGAGGTTC
GACATGCCCTTGAAGAACATGGTTATTTTATAGCACTATATGAGGATGCTAATAATAAAATTTCCAAGGAAATATTTGATGTAATGGAAGAATTA
TTTGATCTCCCCATCGAAACAAAGAGAAAAAACACTTCAGACGTTTACTTCTATCGTTACAAAGGTCAATTATTAACCGCTCCTCTTCACGAAAG
CTTTGGAATCCCACATCCAACTGATGTTGAAGCACTTCAAAGCTTCACCACACTTATGTGGCCACAAGGCAACCAAAGATTTTGTGAAACAATGA
CATCGTACATAAAGGTAGGAGCAGAAATAGAACAGTTGGTTGATAAAATGGTGTTTGAAAGCTACGGATTACCAGAAAAGCACTACGAATCTCAT
GTCGCAACTACTACATACCTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T116830 [Download] [View] Facility Assigned ID: TRXBN27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence