EST details — SGN-E13469

Search information 
Request: 13469Match: SGN-E13469
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24343Clone name: cLED-7-O2
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C182302 is on microarray TOM1: SGN-S1-1-5.4.8.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24343 [cLED-7-O2] Trace: SGN-T50545 EST: SGN-E232036 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E13469Length: 615 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E13469 [] (called/trimmed by facility)
GCACCAGGATTGCTCTGCTCAAAGCCACACAAAGTGAGGCTATTAGAAACTATTACCATGACCATCATGTCATTCAAGATCTCCTTGTTCCTCTT
TACAAGGTCGGTGATTGTCTCGAGTGGGTTCATCGCGAGATGGAGGTATATCCAATTTGGCTGTGCCCACACAGAATTTACAAGCTGCCAGTGAG
ACCAATGATCTACCCTGAACCAGGATTCGAGAAACACAAAAGGCAGGGTGACACCGAATATGCACAAATGTATACTGATGTTGGTGTGTACTATG
TTCCGGGAGCAGTCCTGAGGGGTGAGCCGTTTGATGGTTCAGAGAAATGCCGACAACTTGAGCTTTGGTTGATAGAGAACCATGGATTTCAGGCT
CAATACGCGGTGACTGAGCTGACAGAGAAGAATTTCTGGAGGATGTTTGATAACGGTCTGTACGAGCAATGCAGAAGGAAGTACAAAGCTATCGG
AACGTTCATGAGTGTGTACTATAAATCGAAGAAAGGAAGGAAGACAGAGAAGGAAGTGCAAGAAGCTGAGCAAGAGAAAGCTGAACAAGAGACTC
CTGAAGCAAATTGATTCCGAAGAATAGTAGAATTTCTATGACTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T50545 [Download] [View] Facility Assigned ID: TOVAZ85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence