EST details — SGN-E135960

Search information 
Request: 135960Match: SGN-E135960
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78277Clone name: cLES-5-C24
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178939 is on microarray TOM1: SGN-S1-1-8.4.3.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78277 [cLES-5-C24] Trace: SGN-T98086 EST: SGN-E285603 Direction: 5' Facility: TIGR
Clone: SGN-C178939 [TUS-30-H9] Trace: SGN-T184681 EST: SGN-E372241 Direction: 3' Facility: INRA
Clone: SGN-C178939 [TUS-30-H9] Trace: SGN-T184682 EST: SGN-E372242 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E135960Length: 528 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E135960 [] (called/trimmed by facility)
GTTAAACCATTAATAATAGCGGTTTAACGAATTTCATGGAGAACAGTAGTAACAAAGAGACGGCGATGAGACTTAGAGAGGTGGCCGAAGGAGCA
GTAAAGGCGATTGGGTTAGGGTTTGATATAGTGGATGATTTGAGGTTGAAGTTTTGTAAGGATTATCAGTTGATCTCTGTTGACCATGATCAGGT
GCGAGACATTTCAATTCCTGGTGGAATTTTGGTTCAAAATGTTCCCAAATCTATCAATTGCGATAAAGGCGAACGCATGAGATTTACTTCTGATA
TTCTCTCTTTCTCCCAGATGTCCGAGCGATTTAATCAGGACCTATCCCTTTCTGGTAAGATTCCATCGGGCCATTTCAATGCTGCTTTTGAATAT
ACCACTTGTTGGCAAAAAGACGCTGTCTACACGAAAGCTCTTGCTTTTGATGGGGTCTTCATAACACTCTATAACATTGCATTAGAGAAGGCTCA
AGTTGTACTGCGTGATCATGTTAAACAAGCAATTCCTTCATCTTGGGATCCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T98086 [Download] [View] Facility Assigned ID: TPSAR24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence