EST details — SGN-E13692

Search information 
Request: 13692Match: SGN-E13692
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90300Clone name: cLEW-20-O18
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90300 [cLEW-20-O18] Trace: SGN-T113890 EST: SGN-E299629 Direction: 5' Facility: TIGR
Clone: SGN-C191776 [TUS-63-O6] Trace: SGN-T343406 EST: SGN-E542531 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191776 [TUS-63-O6] Trace: SGN-T343408 EST: SGN-E542533 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E13692Length: 507 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E13692 [] (called/trimmed by facility)
GTTTAAGTTCAATTCGCGTGATGCGGAAGATATTTTCGCGGAATTTTTTGGTGGATCGGATGGGTATAGTAGGAGTACTGGTGGTACTGTACGGA
TTAGGAAAGCTGCGCCGGTGGAGAACAAGTTGCCGTGTACCTTGGAGGAGTTATACAAGGGCTCTAAGAGGAAAATGAAGATTTCAAGGATTGTT
CTTGATGGCGCTGGGTAAGTAAATACCTTACATTATACAAACACCAGCTAATATTTCTGAATAACATCCTCTATCCATATTTGCTATTAGAATCT
GTTATCTAGTTTTCTCAATAAGAAATTTACATTACTTTGCGGAATGAATTACATCTGGCCTATTGACGGGGATAATTCGAGTTGATAGTAGTGAT
TTGATCTTTTGTGTGGTGAATTTGACAGAACATTGCCTAGTAAATCATGTCCATCAAGGTTGGTTATAGTTTTCATATGAATCTGGATCCTTANG
AAGCTACTCCCATCTCTCAACCACTTGAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T113890 [Download] [View] Facility Assigned ID: TRDCZ93THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence