EST details — SGN-E138398

Search information 
Request: 138398Match: SGN-E138398
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82334Clone name: cLET-1-K1
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179508 is on microarray TOM1: SGN-S1-1-7.4.2.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82334 [cLET-1-K1] Trace: SGN-T102387 EST: SGN-E292113 Direction: 5' Facility: TIGR
Clone: SGN-C82334 [cLET-1-K1] Trace: SGN-T102388 EST: SGN-E292114 Direction: 3' Facility: TIGR
Clone: SGN-C179508 [TUS-31-P2] Trace: SGN-T185606 EST: SGN-E373468 Direction: 3' Facility: INRA
Clone: SGN-C179508 [TUS-31-P2] Trace: SGN-T185607 EST: SGN-E373469 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E138398Length: 455 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 3' [See links to 5' reads above]
>SGN-E138398 [] (called/trimmed by facility)
AATAAAAATTGTTCATTGTGCAATCACAATGGGACTTCAACAGCAAGTCAATGAAATGTATTACAAATTATTTTCAAAACTCTATTTCTGAATAA
GATTTAGGATGCACAAGACAATCAAAAGACCCCAACAGAGAATTTAGTTGTTATTTATAGGGCGCCATACAAGTAAATTATCTTCAAAATAACAA
GTTCCAAAAAAAAAAATGCAACAATGGCAGCTTATTTCCTGTTGAAAACTGCAAAATGGAATAGAGATGTATCCAACAGACTGATGAAGAAACAG
TTTTAGTATCTGTGTTCTAACTTCTCCTTTTCCAGGAAGTTCTGCACATACGAGTAGGTTCCGACGAGTGGACCAAGCAAGAGGGTAGCGCTGAT
CCAATTTTCAGACACTTTGTGATGGATCTTACCAGGAAGATCCTTCCATAAACCAGGCATAATTTTCTGTTGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T102388 [Download] [View] Facility Assigned ID: TMEAA61TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence