EST details — SGN-E138843

Search information 
Request: 138843Match: SGN-E138843
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82145Clone name: cLET-1-A6
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179379 is on microarray TOM1: SGN-S1-1-8.2.2.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82145 [cLET-1-A6] Trace: SGN-T102603 EST: SGN-E292329 Direction: 5' Facility: TIGR
Clone: SGN-C179379 [TUS-31-J17] Trace: SGN-T185406 EST: SGN-E373268 Direction: 3' Facility: INRA
Clone: SGN-C179379 [TUS-31-J17] Trace: SGN-T185407 EST: SGN-E373269 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E138843Length: 610 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E138843 [] (called/trimmed by facility)
GAGAAATTAAGCAATAGAGAAAATGGCAGCAACAGGTAGCTCAGCCACAGTTGTTAGAGCAACTCCATTTTTGGGCCAGACCAAATATGCTAACC
CCCTAAGGGATATAGTTCCTATGGGCTCTGCCAGATTCACCATGAGTAATGATTTGTGGTATGGACCTGACCGTGTCAAGTACTTGGGACCATTT
TCTGCTCAAACTCCTTCATACTTGACTGGAGAATTCCCTGGTGATTACGGATGGGATACTGCTGGTTTATCTGCTGATCCCGAGGCCTTTGCTAA
GAACAGAGCTCTTGAGGTTATCCATGGGAGATGGGCCATGCTTGGAGCTTTTGGTTGCATTACACCAGAAGTTCTTGAAAAATGGGTAAAAGTGG
ACTTCAAAGAACCAGTATGGTTCAAAGCTGGAGCCCAGATCTTCATTGAAGGTGGGCTGGACTATTTGGGCAACCCAAACCTTGTCCATGCTCAG
AGCATTCTAGCAGTATTGGGCTTCCAAGTTGTACTAATGGGCCTTGTAGAAGGTTTCAGAATTAATGGGCTTCCTGGAGTTGGTGAAAGCAACAA
TCTCTACCCAGGTGGACAGTACTTTGACCCATTGGGCCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T102603 [Download] [View] Facility Assigned ID: TMEAB03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence