EST details — SGN-E139482

Search information 
Request: 139482Match: SGN-E139482
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C4392Clone name: cLEC-25-F14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C4392 [cLEC-25-F14] Trace: SGN-T28707 EST: SGN-E205291 Direction: 5' Facility: TIGR
Clone: SGN-C186578 [TUS-50-F16] Trace: SGN-T351601 EST: SGN-E550726 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E139482Length: 478 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E139482 [] (called/trimmed by facility)
GTGGTACTCCTCTTTATGCACAGTGTACCACTCTAAATGCAGAGGAATCAGAAGAAATTCAAGAATGTATCGTAGCGTAGGTAGTCCGCCCATCA
GCTTTGAACGAACATTGCGAATTAGAGGGAAAAACAACCCCTCAAGATCAGATTTCTCGGCGAGGACCTTTTTGTTCGTGTCATTGCTCAGTTGA
GCTAGTAATGGCTAATGATGATGATTTCACTTTTTGTCAGGTTGGAGCACCTGATAATCAAGATTATGTGGATACACAGAAGATTGCTCATGATA
TTAGTGAAATTAGAATAAAAGATGAGCCCTCAAATAATGATGGTACTAGTCAAAGTAATGGTGCACCATGGGAAGGTAAATTGGGCAATATTACT
ACCTCAAAGAAGCAGGGAACAGTTGGTTCTTTGTCTTTCACTGTTATAGACACATCTNCAGGCAAGCAAGCAAGTAGAACTTCTGGTCAAGTGGC
ATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T28707 [Download] [View] Facility Assigned ID: TCADV31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence