EST details — SGN-E139825

Search information 
Request: 139825Match: SGN-E139825
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C4543Clone name: cLEC-27-K19
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183885 is on microarray TOM1: SGN-S1-1-6.2.19.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C4543 [cLEC-27-K19] Trace: SGN-T28820 EST: SGN-E204086 Direction: 5' Facility: TIGR
Clone: SGN-C183885 [TUS-43-F11] Trace: SGN-T198012 EST: SGN-E396686 Direction: 3' Facility: INRA
Clone: SGN-C183885 [TUS-43-F11] Trace: SGN-T198013 EST: SGN-E396687 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E139825Length: 620 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E139825 [] (called/trimmed by facility)
TAGCATTTACATACGAATGGATTCTTCAGACCTAGTTTCTCAGGCAAGTTCAAACAGAAATAAGACAGGGATACTCGCGGTGAGTTTCTCAGTTT
TGGTGGCAATGATTCTGCTAGGCCTGATTCTGTTTATGTACATACGTAAAAAGAGGAAACTAAAACTCAAAGAGGATTTTGAGTTGCCACAGTTT
CAACTGTCGATAATAACAAGAGCCACAGATAACTTTTCGGTCAACAATCAGATTGGAGAAGGTGGATATGGACCTGTTTATAAGGGAGTACTCGA
AGAGGGACAAGAAATTGCTGTGAAGAGACTATCAAGGACTTCCATGCAAGGAATTGATGAATTCAAGAACGAAGTTACCTATATTGCCAAGCTTC
AGCATAGAAATCTTGTGAGACTTTTAGGCTGCTGCATTCAAGGGGAAGAAAAGATGTTGATCTACGAATACATGCCTAATAAAAGCCTGGACTCA
TACATATTTGATCAAACAAAGAAAAAGTTACTTGATTGGTCAAGGCGTTTCGACATTATTAATGGAATTGCTCGTGGCTTATTGTATCTCCATCA
GGATTCTAGACTACGTATTATCCATAGAGACCTTAAAGCAAGCAATGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T28820 [Download] [View] Facility Assigned ID: TCAEA70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence