EST details — SGN-C14174

Search information 
Request: 14174Match: SGN-C14174
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14174Clone name: cLEC-7-B23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEC-7-B23.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202009Length: 495 bp (857 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202009 [] (trimmed) CATGGATTATTGGATTGTGAGGAACTCATGGGGTGCTTCCTGGGGAGAACACGGCTACCTCAGGATGCAGCGTAACATTGCTAACCCAAAGGGTT
TGTGTGGTATTGCTACAGTTGTTTCTTACCCTGTCAAGACAGGCCAAAATCCCCCGAAACCAGCTCCATCTCCTCCATCGCCAGTCAAGCCACCT
ACTACTTGTGATGATATGTACAGTTGCCCATCAGGAACAACGTGTTGCTGTGTCTACGAGTACTATCACATGTGCTTTGCTTGGGGTTGCTGCCC
TATGGAAGGAGCTACTTGCTGTAAAGACCATAACAGTTGCTGCCCACATGATTATCCTGTCTGCAATGTTAAAGCCGGCACCTGCTCAATCAGCG
AGAATAACCCTCTTTCAGTCAAAGCAATGTCACACATTCTTGCCAAACCTATTGGATCCTTCAGCAATCANGGAATGAAAAACACTATCTCTTGA
AGTGTCTCCAATGGGAATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202009] SGN-U575308 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25291 [Download] [View] Facility Assigned ID: TCABA12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5