EST details — SGN-E142536

Search information 
Request: 142536Match: SGN-E142536
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48457Clone name: cLEI-4-K1
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C48457 [cLEI-4-K1] Trace: SGN-T80187 EST: SGN-E267040 Direction: 5' Facility: TIGR
Clone: SGN-C188834 [TUS-56-D16] Trace: SGN-T338435 EST: SGN-E537560 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188834 [TUS-56-D16] Trace: SGN-T348787 EST: SGN-E547912 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E142536Length: 618 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E142536 [] (called/trimmed by facility)
GCTCTCTCGCTCATCGTCAGCCCGTGAAAATGTTCAAGAAGTTTTCAACTGAAGAAGTGTCTGGACAAAATCAAGTCAAGGCATCTGTGCAGCGT
AGAATTCGTCAAAGCATTGCAGAAGAGTACCCACTACTAGAGCCAGTGTTGGAAGATCTGCTTCCAAAGAAGTCTCCTCTCATTGTTGCAAAATG
TCAAAATCATCTGAATTTAGTTGTGGTAAACAATGTACCCCTGTTTTTCAACATACGTGATGGACCTTATATGCCTACTTTACGTCTTCTGCATC
AATATCCAAATATAATGAAAAAACTACAAGTTGACAGGGGCGCAATTAAATTTGTCCTCTCTGGAGCCAACATAATGTGTCCAGGTCTTACTTCT
CCTGGGGGTGCTTTGGATGTTGAAGTGGGGGCAGAAACTCCCGTGGCTATTATGGCTGAAGGGAAGCAACATGCTCTAGCTATTGGCTTTACAAA
GATGTCGGCAAAGGATATAAAGGCAATCAACAAAGGAATTGGTGTGGATAACATGCATTATCTTAATGATGGGCTCTGGAAGATGGAGCGTCTGG
ATTGAGCTTTAATGGTATCTCTACTAGATGGACAATGTTTACCTGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T80187 [Download] [View] Facility Assigned ID: TGSAM61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence