Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E143652

Search information 
Request: 143652Match: SGN-E143652
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74048Clone name: cLER-7-J1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C74048 [cLER-7-J1] Trace: SGN-T93603 EST: SGN-E281140 Direction: 5' Facility: TIGR
Clone: SGN-C189783 [TUS-58-L5] Trace: SGN-T339982 EST: SGN-E539107 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189783 [TUS-58-L5] Trace: SGN-T339985 EST: SGN-E539110 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E143652Length: 326 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E143652 [] (called/trimmed by facility)
TTCAAGTTAAAGGGGGAGGATGAGATTCGAGAATCTGGGATACCATATACAATAGTCAGACCTTGTGCCTTAACTGAGGAGCCTGCAGGAGCTGA
TCTCATTTTCGATCAAGGCGACAATATCACGGGGAAGATATCCCGTGAAGAAGTTGCTCGAATATGTGTGGCCGCTCTGAAAAGCCCCTATGCAT
GTGACAAGACATTTGAGGTTAAAAGTGTCATTCCATTTAGTGAGCCGTACACGGTGGATCCAGAAAACCCTCCTCCAGAGAAGGATTACAATGAA
TTCTTCAAGACTCTGAAAGATGGCATCACTGGGAAAGAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T93603 [Download] [View] Facility Assigned ID: TPRBA49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence