EST details — SGN-E14571

Search information 
Request: 14571Match: SGN-E14571
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98485Clone name: cLEZ-10-C15
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C98485 [cLEZ-10-C15] Trace: SGN-T122548 EST: SGN-E309878 Direction: 5' Facility: TIGR
Clone: SGN-C193402 [TUS-68-B24] Trace: SGN-T346205 EST: SGN-E545330 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193402 [TUS-68-B24] Trace: SGN-T350064 EST: SGN-E549189 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E14571Length: 461 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E14571 [] (called/trimmed by facility)
GATTTGTTCGAAGGGGATGCTGAGATTGCCTTTGCTCGTGTTAGAAGCAAGGTGAAAGTTCCACTGTACGGATGTGACTGCTATGCTTATGCCCT
ATTGGCTTCTGGATTTGTGGATCTTGTAGTAGAGTCTGGTCTTAAGCCGTACGACTTCCTCTCACTTGTACCAGTAATAGAAGGTGCTGGAGGAA
CAATAACCGACTGGAAAGGCCAACATTTTAATTGGAAAGCTTCTGCTGGTTCACCAGCCACAAGTTTTAATGTAGTGGCAGCCGGTGATAAAGAA
GTTCACCAAGAAGCTCTGGATGCATTGCAGTGGCGGTAGAGGCTGCTATGTTTCACTGTATTGGCTCACAACTCCCTTTGGCGAATATCATAGTT
ATTGATTACTTTGCCGCTGAGTCTCTACATTAATTTTAACTTTTGAATCAAATTATGGTGGTCCTCTGTTGATAGTTATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T122548 [Download] [View] Facility Assigned ID: TRZBK20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence