EST details — SGN-E145839

Search information 
Request: 145839Match: SGN-E145839
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74187Clone name: cLER-8-C17
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C74187 [cLER-8-C17] Trace: SGN-T93660 EST: SGN-E279758 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E145839Length: 494 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E145839 [] (called/trimmed by facility)
TTTACAAACAATCATCAATACACTCCTCCCTCTTCAAGCCCTTTCTTATATAGGGTCTTGAAGAGCCAAAATCAACATCTGATTATTCTTTCTGT
TTTCTAACAAAACAGAATTTGTCAATAAATGGGTAAAGTCTTCAATTTAGCTGAGGTCTCCCAGCACAACAATGCCAAGGATTGTTGGCTCATTA
TTAGTGGCAAGGTGTATGATGTGACAAAATTCTTGGAGGATCACCCAGGTGGTGATGATGTTTTGTTGTCTGCAACAGGGAAGGATGCAACTGAT
GATTTTGAGGATGTCGGACACAGCAGTAGTGCTCGAGCAATGTTGGACGAGTATTATGTAGGAGAAATCGATTCTTCAACCATCCCAACAAGTGT
AAAGTACACTCCTCCAAAGCAGCCTCATTACAACCAGGACAAAACAACAGAGTTCATCATTAAGATCCTCCAGTTCTTGGTTCCTTTGATTATTT
TGGGAGGTGCTGTTGGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T93660 [Download] [View] Facility Assigned ID: TPRBC21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence