EST details — SGN-E146498

Search information 
Request: 146498Match: SGN-E146498
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17358Clone name: cLED-19-G7
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175910 is on microarray TOM1: SGN-S1-1-5.2.11.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17358 [cLED-19-G7] Trace: SGN-T53532 EST: SGN-E237618 Direction: 5' Facility: TIGR
Clone: SGN-C175910 [TUS-22-J4] Trace: SGN-T180915 EST: SGN-E368733 Direction: 3' Facility: INRA
Clone: SGN-C175910 [TUS-22-J4] Trace: SGN-T180916 EST: SGN-E368734 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E146498Length: 528 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E146498 [] (called/trimmed by facility)
AATTAGAGGCTAAAATTAAATGTTTTTGACACTGAAACATTAATTGTCACTTCATAGATTTTTTTGGGGACGCATAATTTTTCACAAAAGAAAAC
GCTGGGTAGCTGAAGGTAAACACCATCTTGTTTCTTGCTAGGATCTGTCCTTAACGTGATTTTTTGAGAGAGAAATACAAATCATCTGGAAGCCA
CCACAAATGAATCTAACTGAAAGTTCCATAATCTTATAATAGTACTTTAAAGACGATTCAATTAGTCCCTCAAGAGTAATGAGATACAGCCCTAC
CCCACAGACATAATAAGACCCATTCCAATGAGCAATTTCAGCAGCAGCAGCATACTTGATTACCATCTGAACTTCTCTACCTGAGCTGCAAATAG
TTGTACGCATCTTTACTTCTTGTCCTCTTTCTGTTCCTTATCATTGGCCTCATCCTTCTTCTCGGACTGCCCTTGCATGGAAGCAAGCAAATCTT
TGACAGAAGGATCGTTTGGATCAACACCTGGAAGTGAGGCAAGGATTGATGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T53532 [Download] [View] Facility Assigned ID: TOVCU40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence