EST details — SGN-E150317

Search information 
Request: 150317Match: SGN-E150317
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28515Clone name: cLEF-47-O16
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28515 [cLEF-47-O16] Trace: SGN-T61918 EST: SGN-E247889 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E150317Length: 552 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E150317 [] (called/trimmed by facility)
GTTTCTCTTCACTGCTGTATCGTCGTCTCACTTGCCTTTCAGAGGATAACCGGAGCGGCGACCACCTTGCTTGACAAAATGGCGCAAGAATCACT
TGTCCTTCGCGGCACCATGAAAGCCCACACCGATTGGGTCACTGCCATCGCCACCCCAATTGATAACTCTGACATGATTGTTACTTCCTCCAGGG
ACAAGTCCATCATTGTCTGGTCTCTCACCAAGGATGGCGCACAGTACGGTGTCCCCCGCCGCCGTCTCACAGGCCACGGCCACTTTGTTCAGGAT
GTTGTTCTCTCCTCCGACGGTATGTTTGCTCTCTCTGGTTCTTGGGATGGAGAGCTTCGCCTTTGGGATCTTCAAGCCGGCACTACTGCTCGCCG
TTTTGTTGGTCACACTAAGGATGTTCTCTCCGTTGCTTTTTCCGTTGATAACCGTCAGATTGTGTCCGCTTCACGGGACAAGTCTATCAAGTTGT
GGAACACTCTCGGTGAGTGTAAATACACCATTCAGGACGGAGACTCACACTCCGATTGGGTTTCGTGTGTGCGTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T61918 [Download] [View] Facility Assigned ID: TMGHD92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence