EST details — SGN-E150442

Search information 
Request: 150442Match: SGN-E150442
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28329Clone name: cLEF-47-F14
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C180318 is on microarray TOM1: SGN-S1-1-5.1.19.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28329 [cLEF-47-F14] Trace: SGN-T62130 EST: SGN-E248101 Direction: 5' Facility: TIGR
Clone: SGN-C180318 [TUS-34-A20] Trace: SGN-T193751 EST: SGN-E392425 Direction: 3' Facility: INRA
Clone: SGN-C180318 [TUS-34-A20] Trace: SGN-T193752 EST: SGN-E392426 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E150442Length: 533 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E150442 [] (called/trimmed by facility)
TCTGTGTGAGCTGAACTGAGGAACCAGAGAGTATTTATTGGAGCTCATCTTAAGGAAAGGTTCAAAGAGTGGAGCATCTGGTGCATGCTATGGAT
GTCAAGGCACTGGAATGCGTGTTACAAGAAGACAGATCGCTCCAGGAATGATCCAACAGATGCAACATGTTTGTCCTGAATGCCGAGGCTCAGGA
GAGGTTATCAGCGACAGAGACAGGTGCCCACAGTGCAAAGGAAACAAAGTTACTCAAGAAAAGAAGGTGCTGGAAGTGAATGTTGAGAAAGGAAT
GGAACATAACCAGAAGATAACTTTCGAAGGGGAAGCAGATCAAGCTCCCGATACCATCACTGGAGACATTGTTTTTGTTCTACAACAGAAAGAGC
ATCCAAAGTTCAAGCGGAAATTTGATGATCTTTATATTGAACACACACTTACTTTGACTGAAGCTCTTTGTGGCTTTCAGTTTGTCCTAACTCAT
CTTGATGGGAGGCAGCTTTTAATCAAATCGAACCCTGGAGAGTTATAAAGCCTGATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T62130 [Download] [View] Facility Assigned ID: TMGHF31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence