EST details — SGN-E150631

Search information 
Request: 150631Match: SGN-E150631
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69498Clone name: cLER-10-P2
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185985 is on microarray TOM1: SGN-S1-1-2.1.7.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69498 [cLER-10-P2] Trace: SGN-T94064 EST: SGN-E278637 Direction: 5' Facility: TIGR
Clone: SGN-C185985 [TUS-48-M23] Trace: SGN-T188289 EST: SGN-E376249 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E150631Length: 495 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E150631 [] (called/trimmed by facility)
ACTCTACCACCAGTAGATCTACACCGGAAAGCTTCTCTCCGACAGCTTTTCCGATCTGCTATATTGATCGGAATCCGTACTACTTCACATGGCAG
GGGCGGCGTCCGCGCTGTTCCTCCTTGACATCAAAGGCCGGGTCCTCGTCTGGCGTGATTACCGTGGAGACGTCACTTCAGTTCAAGCGGAACGA
TTCTTCACCAAGCTCATTGAAAAAGAGGGCGATCCTCTGGATCCTGTAGCATATGATAATGGCGTGACCTATATGTTTATACAGCATAACAATGT
GTATCTCATGACTGCATCAAGGCAGAACTGTAATGCAGCTAGTCTCCTTCTGTTTCTACACCGTGTCGTAGATGTATTCAAGCATTATTTTGAAG
AGCTAGAAGAAGAATCCCTTCGCGATAATTTTGTTGTGGTGTATGAGCTACTTGATGAAATGATGGACTTTGGTTATCCTCAATATACCGAAGCA
AAAATTCTTAGTGAGTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T94064 [Download] [View] Facility Assigned ID: TPRBN85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence