EST details — SGN-E151050

Search information 
Request: 151050Match: SGN-E151050
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17699Clone name: cLED-20-D23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17699 [cLED-20-D23] Trace: SGN-T53727 EST: SGN-E236210 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E151050Length: 280 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E151050 [] (called/trimmed by facility)
ATGCTTTTGTGGTCAATGTTGGTGACCACCTCGAGATATTTAGCAATGGAAAATACAAAAGTGTGTTACATAGAGTTCTTGTGAACTCTTTAAAG
TCAAGAATTTCAGTGGCTTCTTTGCATAGTCTTCCATTCAATAGCATAATAAAGCCATCACCTAAATTAATTAGTGAAACAAATCCAAGTCTTTA
CAAAGACACAAATTTTGCTGCATTTCTTGAATACTTAAAATCTTGTGATTCCACTAATAAAAGTTTCCTTGAGACAAGAAGGTTAACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T53727 [Download] [View] Facility Assigned ID: TOVDA24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence