EST details — SGN-C15246

Search information 
Request: 15246Match: SGN-C15246
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C15246Clone name: cLED-11-F6
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181228 is on microarray TOM1: SGN-S1-1-7.3.14.4
This clone has been mapped as cLED-11-F6.
Additional sequencing 
Clone: SGN-C181228 [TUS-36-G18] Trace: SGN-T193559 EST: SGN-E392233 Direction: 3' Facility: INRA
Clone: SGN-C181228 [TUS-36-G18] Trace: SGN-T199180 EST: SGN-E397854 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235561Length: 553 bp (784 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E235561 [] (trimmed) CAGCCTGGCTATCCTGAATATATTCTTAAAGCAGGCGACGAGAATTAACTTGGAGGAGTATATTTCTTTGGTAGTTGATGCTACTGTGAAAACTG
GAATCAGGCAGCAAATGGAGGCTTTTAGATCTGGCTTCAATCAGGTTTTCGACTTTTCAGCTCTGCAAATATTCTCTCCTTCAGAGTTAGACTAT
CTATTATGTGGCCGTAGAGAGCTGTGGAAGCCTGAGACGCTAGTAGATCACATAAAATTCGATCATGGATTCACATCCAAGAGTCCTCCTATTAT
TCATTTACTAGAGATTATGGGAGAGTTCACACCTGAGCAGCAACGAGCATTCTGCCAGTTTGTTACTGGTGCTCCTCGGCTCCCCGCAGGTGGTC
TTGCTTCTCTGAATCCTAAGTTGACAATTGTGAGGAAGCATTCATCTAGTGCTGGCAATGCAGCACAGAACAGTAATGCCCCATCAGAATCTGCA
GATGAAGACCTACCCAGTGTGATGACATGTGCTAATTACTTGAAACTCCCTCCCTATTCTACTAAAGAGATCATGTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235561] SGN-U568655 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51571 [Download] [View] Facility Assigned ID: TOVBR27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5