EST details — SGN-E154354

Search information 
Request: 154354Match: SGN-E154354
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27302Clone name: cLEF-43-D4
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C27302 [cLEF-43-D4] Trace: SGN-T60942 EST: SGN-E245523 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E154354Length: 619 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E154354 [] (called/trimmed by facility)
GAGAAGAAGAAGAAGCAAAGAATGGAGAGTTCAGCAGTAGCATCCGATCTGGTGGATTTCTTGAACGCTTCTCCTACAGCTTTTCACGCAGTTGA
TGAAGCAAAGAAGAGACTTAAAAGTGCAGGGTATGTACAGATAGATGAGAAACTAGATTGGGATTTGAAAGCTGGGAACAAGTATTTCTTCACTA
GGAACTACTCTACTATTGTTGCTTTTGCTATCGGTAAAAAATATGTTGCTGGAAATGGATTTCACATAGTTGGTGCTCATACAGATAGTCCTTGT
CTGAAGTTGAAGCCGGTTACGAAGGTAATTAAAAGTGGATTTTTGGAAGTGGGTGTACAAACATATGGTGGAGGGCTGTGGCATACTTGGTTTGA
TCGTGATCTAACAGTTGCCGGAAGGATGATCATAAGAAATAAGAAAGATAGTTCTGAATCCTACTTGCACAAGCTTGTGAGAATTGAGGAGCCTA
TAATGCGAATTCCAACTTTAGCAATTCATTTAGACAGAGGTGTGAATGATGGATTTAAGGTGAACACACAGACCCATCTTCTACCAGTATTGGCT
ACATCAATTAAGGCTGAACTCAATAAGCCAGCTTCCATTGATGATGCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T60942 [Download] [View] Facility Assigned ID: TMGGP14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence