EST details — SGN-E154698

Search information 
Request: 154698Match: SGN-E154698
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C119944Clone name: cTOB-22-D7
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C119944 [cTOB-22-D7] Trace: SGN-T133289 EST: SGN-E320420 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E154698Length: 486 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E154698 [] (called/trimmed by facility)
CTGTTGTTTTGGAGGAGAAAATTAGTGCACTTGAGGGTGCTGAATCAACCTTGATAGTGGCATCTGGAATGTGTGCTAGTACTGTCATGTTCCTG
GCCTTGGTTCCTGCTGGTGGGCATATTGTTACTACTACAGACTGCTACAGGAAGACACGTGTTTTTATTGAGACAATATTACCTAAAATGGGAAT
TACGGCCACAGTTATTGATCCAGCAGATATGGGAGCTTTGGAGTTAGCATTAAATCAGAAGAGAGTGGATCTTTTCTTTACTGAGTCTCCAACAA
ATCCATTCCTGAGATGTGTTGACATTGAGCTGGTTTCAAAGCTTTGCCGTGAAAAACGAGCCTTGGTTTGCATAGATGGAACATTTGCAACTCCT
CTTAACCAGAAGGCCCTTGCTCTAGGGGCTGACCTTGTTGTGCACTCTGCTACAAAATTCCTTGGTGGGCACAACGATGTTCTTGCAGGTTGTAT
TAGTGGGCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T133289 [Download] [View] Facility Assigned ID: TFBDI16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence