EST details — SGN-E155691

Search information 
Request: 155691Match: SGN-E155691
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26366Clone name: cLEF-40-C24
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176290 is on microarray TOM1: SGN-S1-1-1.1.10.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26366 [cLEF-40-C24] Trace: SGN-T59967 EST: SGN-E246115 Direction: 5' Facility: TIGR
Clone: SGN-C176290 [TUS-23-I24] Trace: SGN-T181228 EST: SGN-E369190 Direction: 3' Facility: INRA
Clone: SGN-C176290 [TUS-23-I24] Trace: SGN-T181229 EST: SGN-E369191 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E155691Length: 351 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E155691 [] (called/trimmed by facility)
AAAGATTTGGAAATCGACGTTTGATCGGAGAAGAAATGGTGAAGTGTTATCCGACGGTGAGCGAAGAGTATCAAAAAGCAGTTGAAAAATGTAAG
AAGAAGCTCAGAGGACTTATCGCCGAGAAGAATTGTGCTCCGATTATGCTGAGATTAGCATGGCATTCAGCAGGGACATATGATGTCAAAACCAA
AACTGGTGGTCCATTTGGAACAATCAGGCACCCGAATGAACTTAAACATGGAGCTAACAATGGTCTTGATATTGCTGTTCGACTTTTGGAGCCGA
TCAAGGAACAGTTCCCAATCCTATCCTACGCTGACTTTTATTCAGTTGGCTGGAGTAGTTGCTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T59967 [Download] [View] Facility Assigned ID: TMGGB24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence