EST details — SGN-E156527

Search information 
Request: 156527Match: SGN-E156527
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C143859Clone name: cTOF-24-I24
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C143859 [cTOF-24-I24] Trace: SGN-T158832 EST: SGN-E345884 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E156527Length: 650 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E156527 [] (called/trimmed by facility)
GCCTCATTCTAAAAGCTCTTTTCAGGGATCATCATCAAGGAAGCGTGATGGGGCTCACATTCACCAAGCTCTTCAGTCGGCTTTTCGCCAAGAAG
GAAATGCGCATTCTAATGGTTGGTCTTGATGCAGCTGGTAAGACCACCATATTGTACAAGTTGAAGCTGGGAGAGATCGTGACTACTATTCCTAC
CATTGGTTTCAATGTGGAGACTGTTGAGTACAAGAACATCAGCTTCACTGTTTGGGATGTCGGAGGTCAGGACAAGATCCGTCCATTGTGGAGGC
ACTACTTCCAGAACACTCAGGGTCTCATTTTTGTGGTTGATAGCAATGATAGAGACCGTGTTGTAGAAGCAAGAGATGAATTGCATACGATGTTG
AACGAGGATGAACTTCGGGATGCTGTGCTTCTAGTATTTGCTAACAAACAAGATCTTCCTAACGCAATGAATGCTGCTGAAATAACTGATAAGCT
TGGACTGCACTCCCTCAGGCAGCGTCACTGGTACATCCAGAGCACTTGTGCAACTTCTGGCGAGGGGCTTTATGAGGGACTTGATTGGCTTTCTA
ACAACATTGCTAACAAGGCTTAAAGTGATGCAGATTTGTTATTGTGGGTTGATCCTGGATGCAGGCGGAGTTTTATCTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T158832 [Download] [View] Facility Assigned ID: TOFDP60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence