Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E156581

Search information 
Request: 156581Match: SGN-E156581
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26548Clone name: cLEF-40-M16
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176351 is on microarray TOM1: SGN-S1-1-4.4.10.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26548 [cLEF-40-M16] Trace: SGN-T60134 EST: SGN-E246282 Direction: 5' Facility: TIGR
Clone: SGN-C176351 [TUS-23-L13] Trace: SGN-T181380 EST: SGN-E368453 Direction: 3' Facility: INRA
Clone: SGN-C176351 [TUS-23-L13] Trace: SGN-T181381 EST: SGN-E368454 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E156581Length: 593 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E156581 [] (called/trimmed by facility)
GAGCTAATCACTTTTTGTATTAAAGTTTGCTGGAGATTTGTATTTAATTTGTCGACAAGACAGGAAAAATTCTGGGGTGTTAAGTTTTTCTTGAT
CGTTTTTTGGTGGTATTGAAGTTATGGAAGACAAAAGCAATGATTATTATGCAGTTTTGGGGTTGAAGAAGGAATGCACTGACACAGAACTTAGG
AATGCCTATAAGAAGCTTGCACTGAAATGGCACCCAGATCGCTGTTCAGCATCGGGGAATTTGAAGTTTGTAGATGAAGCAGAAGAAGCAATTTC
AGGCAATTCAAGAAGCATATTCTGTGTTATCGGATGCAAACAAAAAGTTTTTGTACGATGTAGGAGTTTATGACTCTGGTGATGATGACGACGAA
AATGGCATGGGTGATTTCCTGAATGAAATGGCAGCTATGATGAGCCAAAATAAGTCCAATGAAAATCAGGGAGAAGAAACCTTTGAGGAATTGCA
GGATATGTTTAATGAAATGTTCAACAGTGATAATGGAACGTTNTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGGACTGGAACTCCTTCAATGT
GCTCTACTACATCATCTACATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T60134 [Download] [View] Facility Assigned ID: TMGGB80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence