EST details — SGN-E156779

Search information 
Request: 156779Match: SGN-E156779
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167102Clone name: cTOS-8-G8
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167102 [cTOS-8-G8] Trace: SGN-T164155 EST: SGN-E351851 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E156779Length: 398 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E156779 [] (called/trimmed by facility)
TCCAAACGCTACGCAAACTTGTGGTTGTGGAAAATCGTTTACTGCTGAGATGTAAGAGCATGCAGTCTTAGAAATGTACTACAAAATTAACATAC
TAGAACACCAACTGTGGTTTGCTTGGTTCTCTGAATATAGACAGAGACAGTAATGAAGATCTGTTAACTCATATTATGTGCATAAGGGACTGTAA
CGTTTAAATATGTGTAACTGGGAATGCATTATATTCTTCCTGCACAAAATACAAAACATCTATGCCATGTCGTTTTATGCTTCGTGAGGCAGAGC
CGCAATGTAACGTGTGGGTTCATGTAAACTCAATAGTTTTGTGTTGGATCTTGTATATGTATTTTTAAAATATTATTAAATTTATGAAAGATTGT
GAACTCGGTTATTATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T164155 [Download] [View] Facility Assigned ID: TSCBD40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence