EST details — SGN-E157100

Search information 
Request: 157100Match: SGN-E157100
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C29915Clone name: cLEF-55-I18
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C29915 [cLEF-55-I18] Trace: SGN-T63578 EST: SGN-E248282 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E157100Length: 555 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E157100 [] (called/trimmed by facility)
AGGACGTATCTTCAAGCAGACTACACTTACAGGGGAAACTATTCAAGCTACTGAATAGACCAGATGAGTCGAATAACATTACCCCTGTTGTTGTT
ACACAATCAGGAAATGTCGTGGCAAGACTAGAGGAAAAGGTCTTGAAAAAATGAAGAAGTCTATGAGAGGCAAGATGAAGATCGAGATATCAGTT
GGTAAGGGAAGTCCAACTAAACCAACTCAATCAGAAAAAACTATCCAATGAGTTGGGCGTAATTGCCCGGAATTTTCTTCCGCTTCCAAATAAGT
GGAAGGAACTCGCAAGAGAGGACAGAGATGCAGCACTTATTAGATGCCTGGAGAGATTTGAGATTAATTTAGACGAGCATTACGTGAAAGATAGC
TGTGAGGATATTCTGAAAAATAGAAGTCGACAATGGCGCTACAAGTTAAAACAATTATTGAAAGTGCACGCTCCGAGGAAGAAGCTCGTAAAATT
GAAGTGTCAGAGTTGATCCCTGAAAATTGGAACAGGCTTTGTGACGCGTAGATCAATCCAGAGCATAAGAAACGATGCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T63578 [Download] [View] Facility Assigned ID: TMGIJ57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence