EST details — SGN-E157395

Search information 
Request: 157395Match: SGN-E157395
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C92995Clone name: cLEX-13-G11
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C92995 [cLEX-13-G11] Trace: SGN-T117371 EST: SGN-E306278 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E157395Length: 601 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E157395 [] (called/trimmed by facility)
GATCGTAAACTAGGTTTCAAGACTTTAAAGCTGAAGGTGGGCAAGAATTTGAACGGAGACATTGAAGTGCTTCAATCCATACGTGCAGCACATCC
TGATTGCTTGTTTATCTTAGATGCTAATGAAGGTTACACGGCAAATGAAGCTATTAAAGTCCTGGAAAAGTTGCATGAAATGGATGTCACTCCGG
GGCTATTTGAACAACCTGTTCATAGAGATGATTGGAAAGGTCTTGGTCATGTCAGTCACATTGCAAAGGACACATATGGGGTATCTGTTGCTGCC
GATGAAAGTTGTCGAAGTTTGGTTGATGCTAAAAAGATAGTGCAAGAAAGTCTTGCTGATGTCATTAACATTAAGCTTGCCAAAGTTGGGGTGCT
TGGGGCTCTGGAAATTATTGACTTGGTGAGGTCCTCGGGCTTAAATCTGATGATCGGTGGTATGGTTGAAACCAGGCTTGCCATGGGCTTTGCTG
GTCATCTAGCCGCTGGCCTTGGATGTTTCAAATTCATTGACCTAGACACACCCCTTCTGTTGGCAGAAGATCCAGTTTTTGGGGGGTATGAAAGC
TTCTGGACCTGATTACAGCTTCTCAAAATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T117371 [Download] [View] Facility Assigned ID: TRXBW42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence