EST details — SGN-E157440

Search information 
Request: 157440Match: SGN-E157440
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93006Clone name: cLEX-13-G23
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93006 [cLEX-13-G23] Trace: SGN-T117549 EST: SGN-E306456 Direction: 5' Facility: TIGR
Clone: SGN-C192500 [TUS-65-M10] Trace: SGN-T344655 EST: SGN-E543780 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192500 [TUS-65-M10] Trace: SGN-T344656 EST: SGN-E543781 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E157440Length: 552 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E157440 [] (called/trimmed by facility)
GTGCAAATGGGAAGTTCATATCTTATGGCAACTTGAAAATAGATTTAAAATGATGAAGCTACACCCAATAGTACTGCATCTGCTGCTTCCTCTTT
CTCTCTTGCTCTTCTTCCCAAATGTTATTTCTGACCTTACATCAGATAGACAAGCACTACTTGACTTTGCTTCTGCAGTAGCTCATCTTCGAAAC
TTCAAGTGGAACACTAACTCTTCCATTTGCACATGGCATGGCGTAAGTTGCAGCTCAGATGGCACTCGTGTTGTTGCACTTCGCCTTCCTGGACT
TGGACTTTATGGTCCTATTCCAGACAATACCATAGGAAGACTAGATGCACTAACAACACTCAGCCTTCATTCCAATGCCCTCACTGGAAATCTTC
CTTCAGACATCACCTCTCTTCCCTCCCTCCGTTTCATATTTATACAACAAAACAAATTTTCTGGTGAAATACCTTCTTCTCTATCTCTACTCCTT
AAATTCATTGATCTCTCTTTCAACTCCTTCTCAAGGGAAGTTCCAACAACAATTCAAAATCTGACACATCTTACTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T117549 [Download] [View] Facility Assigned ID: TRXBW48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence