Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-E157543

Search information 
Request: 157543Match: SGN-E157543
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93144Clone name: cLEX-13-M9
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93144 [cLEX-13-M9] Trace: SGN-T117568 EST: SGN-E306475 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E157543Length: 593 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E157543 [] (called/trimmed by facility)
GGGTATAACTCCAGTATATCAAGTAATGCAATCAATATTGAAAGATCCTGAAGACGATACAGAGATGTATGTGGTGTATGCAAACAGAACGGAGG
ATGATATTTTGCTCAAAGACGAACTTGATGCATGGGCAGAGCAAGTTCCAAATAGGGTTAAAGTATGGTATGTCGTTCAAGAATCCATTACACAA
GGATGGAAGTATAGTACAGGATTCGTTACAGAATCGATTCTTAGAGAACATATACCTGAACCATCTCATACAACATTGGCATTAGCATGTGGACC
ACCTCCAATGATACAATTTGCTATTAATCCAAACTTGGAGAAAATGGGATATGACATTAAGGAGGAACTATTGGTGTTCTAAATTGGATGGTGAT
GATGATAGATGATATATCTCTTTGGAGGAATAAATTCTTTTGTATTTTCAGTTGTACATATTGTGTTTTTGTTTATCATCAAAATGTACTACTTC
TTGTAGTTCTTACATTTTAATTTTCTACTCAACTTTAGGTATAAAATGTTGTACTGTGTACTAGTATGTGTATGTCAAAGTTAAAGATTGTATTC
ATCATGGAATTACAGTAACTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T117568 [Download] [View] Facility Assigned ID: TRXBW77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence